.. _Usage: ========================================= Working with BAM/CRAM/SAM-formatted files ========================================= Opening a file ============== To begin with, import the pysam module and open a :class:`pysam.AlignmentFile`:: import pysam samfile = pysam.AlignmentFile("ex1.bam", "rb") The above command opens the file :file:`ex1.bam` for reading. The ``b`` qualifier indicates that this is a :term:`BAM` file. To open a :term:`SAM` file, type:: import pysam samfile = pysam.AlignmentFile("ex1.sam", "r") :term:`CRAM` files are identified by a ``c`` qualifier:: import pysam samfile = pysam.AlignmentFile("ex1.cram", "rc") Fetching reads mapped to a :term:`region` ========================================= Reads are obtained through a call to the :meth:`pysam.AlignmentFile.fetch` method which returns an iterator. Each call to the iterator will returns a :class:`pysam.AlignedSegment` object:: iter = samfile.fetch("seq1", 10, 20) for x in iter: print(str(x)) :meth:`pysam.AlignmentFile.fetch` returns all reads overlapping a region sorted by the first aligned base in the :term:`reference` sequence. Note that it will also return reads that are only partially overlapping with the :term:`region`. Thus the reads returned might span a region that is larger than the one queried. Using the pileup-engine ======================= In contrast to :term:`fetching`, the :term:`pileup` engine returns for each base in the :term:`reference` sequence the reads that map to that particular position. In the typical view of reads stacking vertically on top of the reference sequence similar to a multiple alignment, :term:`fetching` iterates over the rows of this implied multiple alignment while a :term:`pileup` iterates over the :term:`columns`. Calling :meth:`~pysam.AlignmentFile.pileup` will return an iterator over each :term:`column` (reference base) of a specified :term:`region`. Each call to the iterator returns an object of the type :class:`pysam.PileupColumn` that provides access to all the reads aligned to that particular reference position as well as some additional information:: iter = samfile.pileup('seq1', 10, 20) for x in iter: print(str(x)) Creating BAM/CRAM/SAM files from scratch ======================================== The following example shows how a new :term:`BAM` file is constructed from scratch. The important part here is that the :class:`pysam.AlignmentFile` class needs to receive the sequence identifiers. These can be given either as a dictionary in a header structure, as lists of names and sizes, or from a template file. Here, we use a header dictionary:: header = { 'HD': {'VN': '1.0'}, 'SQ': [{'LN': 1575, 'SN': 'chr1'}, {'LN': 1584, 'SN': 'chr2'}] } with pysam.AlignmentFile(tmpfilename, "wb", header=header) as outf: a = pysam.AlignedSegment() a.query_name = "read_28833_29006_6945" a.query_sequence="AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG" a.flag = 99 a.reference_id = 0 a.reference_start = 32 a.mapping_quality = 20 a.cigar = ((0,10), (2,1), (0,25)) a.next_reference_id = 0 a.next_reference_start=199 a.template_length=167 a.query_qualities = pysam.qualitystring_to_array("<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") a.tags = (("NM", 1), ("RG", "L1")) outf.write(a) Using streams ============= Pysam does not support reading and writing from true python file objects, but it does support reading and writing from stdin and stdout. The following example reads from stdin and writes to stdout:: infile = pysam.AlignmentFile("-", "r") outfile = pysam.AlignmentFile("-", "w", template=infile) for s in infile: outfile.write(s) It will also work with :term:`BAM` files. The following script converts a :term:`BAM` formatted file on stdin to a :term:`SAM` formatted file on stdout:: infile = pysam.AlignmentFile("-", "rb") outfile = pysam.AlignmentFile("-", "w", template=infile) for s in infile: outfile.write(s) Note that the file open mode needs to changed from ``r`` to ``rb``. ================================================== Using samtools and bcftools commands within Python ================================================== Commands available in `samtools`_ and `bcftools`_ are available as simple function calls, with command line options provided as arguments. For example:: import pysam.samtools pysam.samtools.sort("-o", "output.bam", "ex1.bam", catch_stdout=False) import pysam.bcftools pysam.bcftools.index("--csi", "ex2.vcf.gz") corresponds to the command lines:: samtools sort -o output.bam ex1.bam bcftools index --csi ex2.vcf.gz Samtools commands are also imported into the main ``pysam`` namespace. For example:: pysam.sort("-m", "1000000", "-o", "output.bam", "ex1.bam", catch_stdout=False) To make them valid Python identifiers, the functions :func:`!cram_size` and :func:`!fqimport` are spelt thus, differently from their corresponding commands. In order to get usage information, try:: print(pysam.sort.usage()) Argument errors raise a :class:`pysam.SamtoolsError`:: pysam.sort() Traceback (most recent call last): File "x.py", line 12, in pysam.sort() File "/build/lib.linux-x86_64-2.6/pysam/__init__.py", line 37, in __call__ if retval: raise SamtoolsError( "\n".join( stderr ) ) pysam.SamtoolsError: 'Usage: samtools sort [-n] [-m ] \n' Messages from `samtools`_ on stderr are captured and are available using the :meth:`~PysamDispatcher.get_messages` method:: pysam.sort.get_messages() By default, pysam captures the samtools command's standard output and returns it as the function's return value. To redirect stdout to a file instead, either use the ``save_stdout`` keyword argument, or use ``"-o", "filename"`` in the arguments and also use ``catch_stdout=False`` to prevent pysam's capturing from overriding your redirection. Finally, ``catch_stdout=False`` by itself discards standard output, which may help resolve problems in environments such as IPython notebooks:: # Return value pileup_text = pysam.samtools.mpileup("in.bam") # Save to file pysam.samtools.mpileup("in.bam", save_stdout=pileup_filename) pysam.samtools.mpileup("-o", pileup_filename, "in.bam", catch_stdout=False) # Discard standard output pysam.samtools.mpileup("in.bam", catch_stdout=False) # Returns None For each :obj:`!command` available as a `samtools`_ subcommand, the following functions are provided: .. py:function:: pysam.samtools.command(args, *, catch_stdout=True, save_stdout=None, split_lines=False) :param args: Arguments to be passed to the samtools subcommand. :param bool catch_stdout: Whether to return stdout as the function's value. :param str save_stdout: Filename to which stdout should be written. :param bool split_lines: Whether to split the return value into a list of lines. :returns: Standard output if it was caught, otherwise None. If `save_stdout` is not None, the command's standard ouput is written to the file specified and the function returns None. Otherwise, if `catch_stdout` is true, the command's standard output is captured and used as the function's return value --- either as a single :obj:`str` or as :obj:`list[str] ` according to `split_lines`. If `catch_stdout` is false, the command's standard output is discarded and the function returns None. The command's standard error is always captured and made available via :func:`~pysam.samtools.command.get_messages`. .. py:function:: pysam.samtools.command.get_messages() Returns the standard error from the most recent invocation of the particular :obj:`!command`, either as a single :obj:`str` or as :obj:`list[str] ` according to `split_lines` as specified in that invocation. .. py:function:: pysam.samtools.command.usage() Returns the command's usage/help message, as a single :obj:`str`. For each :obj:`!command` available as a `bcftools`_ subcommand, the :func:`!pysam.bcftools.command`, :func:`!pysam.bcftools.command.get_messages`, and :func:`!pysam.bcftools.command.usage` functions operate similarly. ================================ Working with tabix-indexed files ================================ To open a tabular file that has been indexed with tabix_, use :class:`~pysam.TabixFile`:: import pysam tbx = pysam.TabixFile("example.bed.gz") Similar to :class:`~pysam.AlignmentFile.fetch`, intervals within a region can be retrieved by calling :meth:`~pysam.TabixFile.fetch()`:: for row in tbx.fetch("chr1", 1000, 2000): print(str(row)) This will return a tuple-like data structure in which columns can be retrieved by numeric index:: for row in tbx.fetch("chr1", 1000, 2000): print("chromosome is", row[0]) By providing a parser to :class:`~pysam.AlignmentFile.fetch` or :class:`~pysam.TabixFile`, the data will we presented in parsed form:: for row in tbx.fetch("chr1", 1000, 2000, parser=pysam.asTuple()): print("chromosome is", row.contig) print("first field (chrom)=", row[0]) Pre-built parsers are available for :term:`bed` (:class:`~pysam.asBed`) formatted files and :term:`gtf` (:class:`~pysam.asGTF`) formatted files. Thus, additional fields become available through named access, for example:: for row in tbx.fetch("chr1", 1000, 2000, parser=pysam.asBed()): print("name is", row.name) .. Currently inactivated as pileup deprecated .. Using the samtools SNP caller .. ----------------------------- .. There are two ways to access the samtools SNP caller. The :class:`pysam.IteratorSNPCalls` .. is appropriate when calling many consecutive SNPs, while :class:`pysam.SNPCaller` is .. best when calling SNPs at non-consecutive genomic positions. Each snp caller returns objects of .. type :class:`pysam.SNPCall`. .. To use :class:`pysam.IteratorSNPCalls`, associate it with a :class:`pysam.IteratorColumn`:: .. samfile = pysam.AlignmentFile( "ex1.bam", "rb") .. fastafile = pysam.Fastafile( "ex1.fa" ) .. pileup_iter = samfile.pileup( stepper = "samtools", fastafile = fastafile ) .. sncpall_iter = pysam.IteratorSNPCalls(pileup_iter) .. for call in snpcall_iter: .. print(str(call)) .. Usage of :class:`pysam.SNPCaller` is similar:: .. samfile = pysam.AlignmentFile( "ex1.bam", "rb") .. fastafile = pysam.Fastafile( "ex1.fa" ) .. pileup_iter = samfile.pileup( stepper = "samtools", fastafile = fastafile ) .. snpcaller = pysam.SNPCaller.call(pileup_iter) .. print(snpcaller( "chr1", 100 )) .. Note the use of the option *stepper* to control which reads are included in the .. in the :term:`pileup`. The ``samtools`` stepper implements the same read selection .. and processing as in the samtools pileup command. .. Calling indels works along the same lines, using the :class:`pysam.IteratorIndelCalls` .. and :class:`pysam.IteratorIndelCaller`. ==================================== Working with VCF/BCF formatted files ==================================== To iterate through a VCF/BCF formatted file use :class:`~pysam.VariantFile`:: from pysam import VariantFile bcf_in = VariantFile("test.bcf") # auto-detect input format bcf_out = VariantFile('-', 'w', header=bcf_in.header) for rec in bcf_in.fetch('chr1', 100000, 200000): bcf_out.write(rec) :meth:`_pysam.VariantFile.fetch()` iterates over :class:`~pysam.VariantRecord` objects which provides access to simple variant attributes such as :class:`~pysam.VariantRecord.contig`, :class:`~pysam.VariantRecord.pos`, :class:`~pysam.VariantRecord.ref`:: for rec in bcf_in.fetch(): print(rec.pos) but also to complex attributes such as the contents to the :class:`~pysam.VariantRecord.info`, :class:`~pysam.VariantRecord.format` and :term:`genotype` columns. These complex attributes are views on the underlying htslib data structures and provide dictionary-like access to the data:: for rec in bcf_in.fetch(): print(rec.info) print(rec.info.keys()) print(rec.info["DP"]) The :py:attr:`~pysam.VariantFile.header` attribute (:class:`~pysam.VariantHeader`) provides access information stored in the :term:`vcf` header. The complete header can be printed:: >>> print(bcf_in.header) ##fileformat=VCFv4.2 ##FILTER= ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=1000GenomesPilot-NCBI36 ##phasing=partial ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##INFO= ##FILTER= ##FILTER= ##FORMAT= ##FORMAT= ##FORMAT= ##FORMAT= ##contig= ##contig= ##contig= ##bcftools_viewVersion=1.3+htslib-1.3 ##bcftools_viewCommand=view -O b -o example_vcf42.bcf example_vcf42.vcf.gz #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA0000 Individual contents such as contigs, info fields, samples, formats can be retrieved as attributes from :py:attr:`~pysam.VariantFile.header`:: >>> print(bcf_in.header.contigs) To convert these views to native python types, iterate through the views:: >>> print(list((bcf_in.header.contigs))) ['M', '17', '20'] >>> print(list((bcf_in.header.filters))) ['PASS', 'q10', 's50'] >>> print(list((bcf_in.header.info))) ['NS', 'DP', 'AF', 'AA', 'DB', 'H2'] >>> print(list((bcf_in.header.samples))) ['NA00001', 'NA00002', 'NA00003'] Alternatively, it is possible to iterate through all records in the header returning objects of type :py:class:`~pysam.VariantHeaderRecord`:: :: >>> for x in bcf_in.header.records: >>> print(x) >>> print(x.type, x.key) GENERIC fileformat FILTER FILTER GENERIC fileDate GENERIC source GENERIC reference GENERIC phasing INFO INFO INFO INFO INFO INFO INFO INFO INFO INFO INFO INFO FILTER FILTER FILTER FILTER FORMAT FORMAT FORMAT FORMAT FORMAT FORMAT FORMAT FORMAT CONTIG contig CONTIG contig CONTIG contig GENERIC bcftools_viewVersion GENERIC bcftools_viewCommand =============== Extending pysam =============== Using pyximport_, it is (relatively) straight-forward to access pysam internals and the underlying `samtools`_ library. An example is provided in the :file:`tests` directory. The example emulates the samtools flagstat command and consists of three files: 1. The main script :file:`pysam_flagstat.py`. The important lines in this script are:: import pyximport pyximport.install() import _pysam_flagstat ... flag_counts = _pysam_flagstat.count(pysam_in) The first part imports, sets up pyximport_ and imports the cython module :file:`_pysam_flagstat`. The second part calls the ``count`` method in :file:`_pysam_flagstat`. 2. The cython implementation :file:`_pysam_flagstat.pyx`. This script imports the pysam API via:: from pysam.libcalignmentfile cimport AlignmentFile, AlignedSegment This statement imports, amongst others, :class:`AlignedSegment` into the namespace. Speed can be gained from declaring variables. For example, to efficiently iterate over a file, an :class:`AlignedSegment` object is declared:: # loop over samfile cdef AlignedSegment read for read in samfile: ... 3. A :file:`pyxbld` providing pyximport_ with build information. Required are the locations of the samtools and pysam header libraries of a source installation of pysam plus the :file:`csamtools.so` shared library. For example:: def make_ext(modname, pyxfilename): from distutils.extension import Extension import pysam return Extension(name=modname, sources=[pyxfilename], extra_link_args=pysam.get_libraries(), include_dirs=pysam.get_include(), define_macros=pysam.get_defines()) If the script :file:`pysam_flagstat.py` is called the first time, pyximport_ will compile the cython_ extension :file:`_pysam_flagstat.pyx` and make it available to the script. Compilation requires a working compiler and cython_ installation. Each time :file:`_pysam_flagstat.pyx` is modified, a new compilation will take place. pyximport_ comes with cython_.